Your browser doesn't support javascript.
Mostrar: 20 | 50 | 100
Resultados 1 - 20 de 76
Filtrar
1.
Sci Adv ; 9(22): eadf0211, 2023 06 02.
Artículo en Inglés | MEDLINE | ID: covidwho-20242861

RESUMEN

The emergence of a series of SARS-CoV-2 variants has necessitated the search for broad-spectrum antiviral targets. The aryl hydrocarbon receptor (AhR) senses tryptophan metabolites and is an immune regulator. However, the role of AhR in SARS-CoV-2 infection and whether AhR can be used as the target of antiviral therapy against SARS-CoV-2 and its variants are yet unclear. Here, we show that infection with SARS-CoV-2 activates AhR signaling and facilitates viral replication by interfering with IFN-I-driven antiviral immunity and up-regulating ACE2 receptor expression. The pharmacological AhR blockade or AhR knockout reduces SARS-CoV-2 and its variants' replication in vitro. Drug targeting of AhR with AhR antagonists markedly reduced SARS-CoV-2 and its variants' replication in vivo and ameliorated lung inflammation caused by SARS-CoV-2 infection in hamsters. Overall, AhR was a SARS-CoV-2 proviral host factor and a candidate host-directed broad-spectrum target for antiviral therapy against SARS-CoV-2 and its variants, including Delta and Omicron, and potentially other variants in the future.


Asunto(s)
COVID-19 , SARS-CoV-2 , Humanos , Antivirales/farmacología , Antivirales/uso terapéutico , Provirus/metabolismo , Receptores de Hidrocarburo de Aril/genética , Receptores de Hidrocarburo de Aril/metabolismo , SARS-CoV-2/metabolismo
2.
BMC Pediatr ; 23(1): 207, 2023 05 01.
Artículo en Inglés | MEDLINE | ID: covidwho-2322017

RESUMEN

BACKGROUND: Recently the prevalence of precocious puberty development is increasing among Chinese children. Proper understanding of the risk factors for precocious puberty in children is pivotal as could help to improve children's health. This study aims to evaluate the effect of environmental factors on precocious puberty in children. METHODS: We matched the cases and controls by age at the ratio of 1:1 (201 cases and 201 controls) for girls and 1:4 (24 cases and 96 controls) for boys. We used conditional logistic regression to explore the effect of environmental factors on precocious puberty, and a random forest model to identify the most important risk factor. RESULTS: In the multivariate regression, cesarean section (OR = 1.99, 95% CI: 1.05, 3.76), child body mass index [BMI] (OR = 1.25, 95% CI: 1.10, 1.43), maternal BMI (OR = 1.13, 95%CI: 1.01, 1.26), and exposure to secondhand smoke several times a month but less than once a week (OR = 4.09, 95%CI: 1.79,9.35), and almost every day (OR = 6.48, 95% CI: 2.14, 19.56) were risk factors for precocious puberty in girls. While maternal height (OR = 0.82, 95% CI: 0.75, 0.88), paternal height (OR = 0.91, 95% CI: 0.85, 0.98), bedtime at night (OR = 0.30, 95% CI: 0.17, 0.51), and night sleep (OR = 0.43, 95% CI: 0.21, 0.86) were protective factors. In boys, only exposure to secondhand smoke several times a month but less than once a week (OR = 7.94, 95% CI: 1.25, 50.33) was a risk factor for precocious puberty. In the random forest model, Child BMI was the most important risk factor for precocious puberty in girls. CONCLUSIONS: Our findings suggest that environmental factors were associated with precocious puberty in children, particularly in girls.


Asunto(s)
Pubertad Precoz , Contaminación por Humo de Tabaco , Embarazo , Masculino , Humanos , Niño , Femenino , Pubertad Precoz/epidemiología , Estudios de Casos y Controles , Cesárea/efectos adversos , Padre
3.
Mutat Res Rev Mutat Res ; 790: 108440, 2022.
Artículo en Inglés | MEDLINE | ID: covidwho-2308772

RESUMEN

In higher eukaryotes, sophisticate regulation of genome function requires all chromosomes to be packed into a single nucleus. Micronucleus (MN), the dissociative nucleus-like structure frequently observed in aging and multiple disease settings, has critical, yet under-recognized, pathophysiological functions. Micronuclei (MNi) have recently emerged as major sources of cytosolic DNA that can activate the cGAS-STING axis in a cell-intrinsic manner. However, MNi induced from different genotoxic stressors display great heterogeneity in binding or activating cGAS and the signaling responses downstream of the MN-induced cGAS-STING axis have divergent outcomes including autoimmunity, autoinflammation, metastasis, or cell death. Thus, full characterization of molecular network underpinning the interplay of cGAS and MN is important to elucidate the pathophysiological roles of immunogenic MN and design improved drugs that selectively target cancer via boosting the MN-derived cGAS-STING axis. Here, we summarize our current understanding of the mechanisms for self-DNA discrimination by cGAS. We focus on discussing how MN immunogencity is dictated by multiple mechanisms including integrity of micronuclear envelope, state of nucleosome and DNA, competitive factors, damaged mitochondrial DNA and micronucleophagy. We also describe emerging links between immunogenic MN and human diseases including cancer, neurodegenerative diseases and COVID-19. Particularly, we explore the exciting concept of inducing immunogenic MN as a therapeutic approach in treating cancer. We propose a new theoretical framework to describe immunogenic MN as a biological sensor to modulate cellular processes in response to genotoxic stress and provide perspectives on developing novel experimental approaches to unravel the complexity of MN immunogenicity regulation and immunogenic MN pathophysiology.


Asunto(s)
COVID-19 , Neoplasias , Humanos , Proteínas de la Membrana/genética , Proteínas de la Membrana/metabolismo , Nucleotidiltransferasas/genética , Nucleotidiltransferasas/metabolismo , ADN/metabolismo , Neoplasias/genética , Inmunidad Innata/genética
4.
Zhonghua Wei Zhong Bing Ji Jiu Yi Xue ; 35(1): 32-36, 2023 Jan.
Artículo en Chino | MEDLINE | ID: covidwho-2306016

RESUMEN

OBJECTIVE: To analyze the epidemic characteristics and clinical key indicators of the patients infected with SARS-CoV-2 of the local Omicron variant epidemic, to understand the clinical characteristics of mild and severe patients, and to provide a scientific basis for the effective treatment and prevention of severe disease. METHODS: From January 2020 to March 2022, the clinical and laboratory data of COVID-19 patients admitted to the Fifth People's Hospital of Wuxi were retrospective analyzed, including virus gene subtypes, demographic information, clinical classification, main clinical symptoms, and key indicators of clinical testing, and the changes of clinical characteristics of the patients infected with SARS-CoV-2. RESULTS: A total of 150 patients with SARS-CoV-2 infection were admitted, 78, 52 and 20 in 2020, 2021 and 2022, including 10, 1 and 1 severe patient, and the main infected virus strains were L, Delta, and Omicron variants. The relapse rate of patients infected with the Omicron variant was as high as 15.0% (3/20), the incidence of diarrhea decreased to 10.0% (2/20), the incidence of severe disease decreased to 5.0% (1/20), and the number of hospitalization days of mild patients increased compared with 2020 (days: 20.43±1.78 vs. 15.84±1.12); respiratory symptoms were reduced, and the proportion of pulmonary lesions decreased to 10.5%; the virus titer of severely ill patients with SARS-CoV-2 Omicron variant infection (day 3) was higher than that of L-type strain (Ct value: 23.92±1.16 vs. 28.19±1.54). The acute plasma cytokines interleukin (IL-6, IL-10) and tumor necrosis factor-α (TNF-α) were significantly lower in patients with severe Omicron variant new coronavirus infection than those with mild disease [IL-6 (ng/L): 3.92±0.24 vs. 6.02±0.41, IL-10 (ng/L): 0.58±0.01 vs. 4.43±0.32, TNF-α (ng/L): 1.73±0.02 vs. 6.91±1.25, all P < 0.05], while γ-interferon (IFN-γ) and IL-17A were significantly higher than patients with mild disease [IFN-γ (ng/L): 23.07±0.17 vs. 13.52±2.34, IL-17A (ng/L): 35.58±0.08 vs. 26.39±1.37, both P < 0.05]. Compared with previous epidemics (2020 and 2021), the proportion of CD4/CD8 ratio, lymphocyte count, eosinophil and serum creatinine decreased in patients with mild Omicron infection in 2022 (36.8% vs. 22.1%, 9.8%; 36.8% vs. 23.5%, 7.8%; 42.1% vs. 41.2%, 15.7%; 42.1% vs. 19.1%, 9.8%), the proportion of patients with elevated monocyte count and procalcitonin was large (42.1% vs. 50.0%, 23.5%; 21.1% vs. 5.9%, 0). CONCLUSIONS: The incidences of severe disease in patients with SARS-CoV-2 Omicron variant infection was significantly lower than that of previous epidemics, and the occurrence of severe diseases was still related to the underlying diseases.


Asunto(s)
COVID-19 , Epidemias , Humanos , SARS-CoV-2 , Interleucina-10 , Interleucina-17 , Interleucina-6 , Estudios Retrospectivos , Factor de Necrosis Tumoral alfa
5.
Frontiers in psychiatry ; 14, 2023.
Artículo en Inglés | EuropePMC | ID: covidwho-2288055

RESUMEN

Backgrounds The widespread coronavirus disease 2019 (COVID-19) outbreak impacted the mental health of infected patients admitted to Fangcang shelter hospital a large-scale, temporary structure converted from existing public venues to isolate patients with mild or moderate symptoms of COVID-19 infection. Objective This study aimed to investigate the risk factors of the infected patients from a new pharmacological perspective based on psychiatric drug consumption rather than questionnaires for the first time. Methods We summarised the medical information and analysed the prevalence proportion, characteristics, and the related risk factors of omicron variants infected patients in the Fangcang Shelter Hospital of the National Exhibition and Convention Center (Shanghai) from 9 April 2022 to 31 May 2022. Results In this study, 6,218 individuals at 3.57% of all admitted patients in the Fangcang shelter were collected suffering from mental health problems in severe conditions including schizophrenia, depression, insomnia, and anxiety who needed psychiatric drug intervention. In the group, 97.44% experienced their first prescription of psychiatric drugs and had no diagnosed historical psychiatric diseases. Further analysis indicated that female sex, no vaccination, older age, longer hospitalization time, and more comorbidities were independent risk factors for the drug-intervened patients. Conclusion This is the first study to analyse the mental health problems of omicron variants infected patients hospitalised in Fangcang shelter hospitals. The research demonstrated the necessity of potential mental and psychological service development in Fangcang shelters during the COVID-19 pandemic and other public emergency responses.

6.
Education & Training ; 65(2):265-283, 2023.
Artículo en Inglés | ProQuest Central | ID: covidwho-2286199

RESUMEN

PurposeNowadays, the breakout of the COVID-19 pandemic has caused an important change in teaching models. The emotional experience of this change has an important impact on online teaching. This paper aims to explore its time evolution characteristics and provide reference for the development of online teaching in the post epidemic era.Design/methodology/approachThe article firstly crawls the online teaching-related comment text data on Zhihu platform and performs emotional calculation to obtain a one-dimensional time series of daily average emotional values. Then, by using non-linear time-series analysis, this paper reconstructs the daily average emotion value time series in high-dimensional phase space, calculates the maximum Lyapunov exponent and correlation dimension and finally, explores the feature patterns through recurrence plot and recurrence quantification analysis.FindingsIt was found that the sequence has typical non-linear chaotic characteristics;its correlation dimension indicates that it contains obvious fractal characteristics;the public emotional evolution shows a cyclical rise and fall. By text mining and temporal evolution analysis, this paper explores the evolution law over chronically of the daily average emotion value time series, provides feasible strategies to improve students' online learning experience and quality and continuously optimizes this new teaching model in the era of pandemic.Originality/valueBased on social knowledge sharing platform of Q&A, this paper models and analyzes users interaction data under online teaching-related topics. This paper explores the evolution law over a long time period of the daily average emotion value time series using text mining and temporal evolution analysis. It then offers workable solutions to enhance the quality and experience of students' online learning, and it continuously improves this new teaching model in the age of pandemics.

7.
Sci Rep ; 13(1): 5024, 2023 03 28.
Artículo en Inglés | MEDLINE | ID: covidwho-2288939

RESUMEN

With the continuous development of information technology and the running speed of computers, the development of informatization has led to the generation of increasingly more medical data. Solving unmet needs such as employing the constantly developing artificial intelligence technology to medical data and providing support for the medical industry is a hot research topic. Cytomegalovirus (CMV) is a kind of virus that exists widely in nature with strict species specificity, and the infection rate among Chinese adults is more than 95%. Therefore, the detection of CMV is of great importance since the vast majority of infected patients are in a state of invisible infection after the infection, except for a few patients with clinical symptoms. In this study, we present a new method to detect CMV infection status by analyzing high-throughput sequencing results of T cell receptor beta chains (TCRß). Based on the high-throughput sequencing data of 640 subjects from cohort 1, Fisher's exact test was performed to evaluate the relationship between TCRß sequences and CMV status. Furthermore, the number of subjects with these correlated sequences to different degrees in cohort 1 and cohort 2 were measured to build binary classifier models to identify whether the subject was CMV positive or negative. We select four binary classification algorithms: logistic regression (LR), support vector machine (SVM), random forest (RF), and linear discriminant analysis (LDA) for side-by-side comparison. According to the performance of different algorithms corresponding to different thresholds, four optimal binary classification algorithm models are obtained. The logistic regression algorithm performs best when Fisher's exact test threshold is 10-5, and the sensitivity and specificity are 87.5% and 96.88%, respectively. The RF algorithm performs better at the threshold of 10-5, with a sensitivity of 87.5% and a specificity of 90.63%. The SVM algorithm also achieves high accuracy at the threshold value of 10-5, with a sensitivity of 85.42% and specificity of 96.88%. The LDA algorithm achieves high accuracy with 95.83% sensitivity and 90.63% specificity when the threshold value is 10-4. This is probably because the two-dimensional distribution of CMV data samples is linearly separable, and linear division models such as LDA are more effective, while the division effect of nonlinear separable algorithms such as random forest is relatively inaccurate. This new finding may be a potential diagnostic method for CMV and may even be applicable to other viruses, such as the infectious history detection of the new coronavirus.


Asunto(s)
Inteligencia Artificial , Infecciones por Citomegalovirus , Adulto , Humanos , Citomegalovirus/genética , Algoritmos , Infecciones por Citomegalovirus/diagnóstico , Secuenciación de Nucleótidos de Alto Rendimiento , Receptores de Antígenos de Linfocitos T
8.
Front Psychiatry ; 14: 1100849, 2023.
Artículo en Inglés | MEDLINE | ID: covidwho-2288056

RESUMEN

Backgrounds: The widespread coronavirus disease 2019 (COVID-19) outbreak impacted the mental health of infected patients admitted to Fangcang shelter hospital a large-scale, temporary structure converted from existing public venues to isolate patients with mild or moderate symptoms of COVID-19 infection. Objective: This study aimed to investigate the risk factors of the infected patients from a new pharmacological perspective based on psychiatric drug consumption rather than questionnaires for the first time. Methods: We summarised the medical information and analysed the prevalence proportion, characteristics, and the related risk factors of omicron variants infected patients in the Fangcang Shelter Hospital of the National Exhibition and Convention Center (Shanghai) from 9 April 2022 to 31 May 2022. Results: In this study, 6,218 individuals at 3.57% of all admitted patients in the Fangcang shelter were collected suffering from mental health problems in severe conditions including schizophrenia, depression, insomnia, and anxiety who needed psychiatric drug intervention. In the group, 97.44% experienced their first prescription of psychiatric drugs and had no diagnosed historical psychiatric diseases. Further analysis indicated that female sex, no vaccination, older age, longer hospitalization time, and more comorbidities were independent risk factors for the drug-intervened patients. Conclusion: This is the first study to analyse the mental health problems of omicron variants infected patients hospitalised in Fangcang shelter hospitals. The research demonstrated the necessity of potential mental and psychological service development in Fangcang shelters during the COVID-19 pandemic and other public emergency responses.

9.
Front Public Health ; 11: 1145669, 2023.
Artículo en Inglés | MEDLINE | ID: covidwho-2286163

RESUMEN

Background: Recent studies have shown that the infectivity of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) is reduced under alkaline conditions. The purpose of this study is to assess the effect of nasal irrigation and oral rinse with sodium bicarbonate solution on virus clearance among COVID-19 patients. Materials and methods: COVID-19 patients were recruited and randomly divided into two group, i.e., the experimental group and the control group. The experimental group received regular care plus nasal irrigation and oral rinse with 5% sodium bicarbonate solution, while the control group only received regular care. Nasopharyngeal and oropharyngeal swab samples were collected daily for reverse transcription-polymerase chain reaction (RT-PCR) assays. The negative conversion time and hospitalization time of the patients were recorded, and the results were statistically analyzed. Results: A total of 55 COVID-19 patients with mild or moderate symptoms were included in our study. There was no significant difference in gender, age and health status between the two groups. The average negative conversion time was 1.63 days after treatment with sodium bicarbonate, and the average hospitalization time of the control group and the experimental group were 12.53 and 7.7 days, respectively. Conclusions: Nasal irrigation and oral rinse with 5% sodium bicarbonate solution is effective in virus clearance for COVID-19 patients.


Asunto(s)
COVID-19 , Humanos , COVID-19/terapia , SARS-CoV-2 , Bicarbonato de Sodio/uso terapéutico , Lavado Nasal (Proceso)
10.
Virol J ; 20(1): 42, 2023 03 05.
Artículo en Inglés | MEDLINE | ID: covidwho-2277201

RESUMEN

As the worldwide spreading epidemic of SARS-CoV-2, quick inspection and quarantine of passengers for SARS-CoV-2 infection are essential for controlling the spread of SARS-CoV-2, especially the cross-border transmission. This study reports a SARS-CoV-2 genome sequencing method based on a re-sequencing tiling array successfully used in border inspection and quarantine. The tiling array chip has four cores, with one core of 240,000 probes dedicated to the whole genome sequencing of the SAR-CoV-2 genome. The assay protocol has been improved to reduce the detection time to within one day and can detect 96 samples in parallel. The detection accuracy has been validated. This fast and simple procedure is also of low cost and high accuracy, and it is particularly suitable for the rapid tracking of viral genetic variants in custom inspection applications. Combining these properties means this method has significant application potential in the clinical investigation and quarantine of SARS-CoV-2. We used this SARS-CoV-2 genome re-sequencing tiling array to inspect and quarantine China's entry and exit ports in the Zhejiang Province. From November 2020 to January 2022, we observed the gradual shift of SARS-CoV-2 variants from the D614G type to the Delta Variant, and then to the dominance of the Omicron variant recently, consistently with the global emergency pattern of the new SARS-CoV-2 variant.


Asunto(s)
COVID-19 , SARS-CoV-2 , Humanos , Cuarentena , Mapeo Cromosómico
11.
Mol Ther ; 31(4): 1136-1158, 2023 04 05.
Artículo en Inglés | MEDLINE | ID: covidwho-2246827

RESUMEN

Boosting protein production is invaluable in both industrial and academic applications. We discovered a novel expression-increasing 21-mer cis-regulatory motif (Exin21) that inserts between SARS-CoV-2 envelope (E) protein-encoding sequence and luciferase reporter gene. This unique Exin21 (CAACCGCGGTTCGCGGCCGCT), encoding a heptapeptide (QPRFAAA, designated as Qα), significantly (34-fold on average) boosted E production. Both synonymous and nonsynonymous mutations within Exin21 diminished its boosting capability, indicating the exclusive composition and order of 21 nucleotides. Further investigations demonstrated that Exin21/Qα addition could boost the production of multiple SARS-CoV-2 structural proteins (S, M, and N) and accessory proteins (NSP2, NSP16, and ORF3), and host cellular gene products such as IL-2, IFN-γ, ACE2, and NIBP. Exin21/Qα enhanced the packaging yield of S-containing pseudoviruses and standard lentivirus. Exin21/Qα addition on the heavy and light chains of human anti-SARS-CoV monoclonal antibody robustly increased antibody production. The extent of such boosting varied with protein types, cellular density/function, transfection efficiency, reporter dosage, secretion signaling, and 2A-mediated auto-cleaving efficiency. Mechanistically, Exin21/Qα increased mRNA synthesis/stability, and facilitated protein expression and secretion. These findings indicate that Exin21/Qα has the potential to be used as a universal booster for protein production, which is of importance for biomedicine research and development of bioproducts, drugs, and vaccines.


Asunto(s)
COVID-19 , Vacunas Virales , Humanos , SARS-CoV-2/genética , Transducción de Señal , ARN Mensajero/genética
12.
J Med Virol ; 95(2): e28562, 2023 02.
Artículo en Inglés | MEDLINE | ID: covidwho-2228787

RESUMEN

People's lifestyles have changed dramatically during the coronavirus disease 2019 (COVID-19) pandemic, yet data on physical examinations in the Chinese population before and during the pandemic are rarely reported. The study was based on the data from the physical examination center of Affiliated Hospital of Integrated Traditional Chinese and Western Medicine, Nanjing University of Chinese Medicine. We collected the data of physical examinations information between January 2017 and March 2022. The data of participants before December 31, 2019 were classified as "before COVID-19 pandemic group," while data after December 31, 2019 were classified as "during COVID-19 pandemic group." We used t-test and χ2  test to compare the differences before and during COVID-19 pandemic. A total of 72 257 individuals participated in the physical examinations, and finally retained 65 629 individuals for analysis. During the COVID-19 pandemic, body mass index (BMI), high-density lipoprotein, total cholesterol levels, as well as pulmonary nodule and thyroid nodule proportion of participants were higher than those before the pandemic, and the levels of systolic blood pressure and diastolic blood pressure of participants were lower than those before the pandemic. Ongoing assessment and surveillance are necessary to assess whether lifestyle changes caused by the COVID-19 pandemic are likely to increase chronic disease risk in the future.


Asunto(s)
COVID-19 , Humanos , Pandemias , Estudios Transversales , SARS-CoV-2 , Estilo de Vida
13.
Biosensors (Basel) ; 13(2)2023 Feb 04.
Artículo en Inglés | MEDLINE | ID: covidwho-2225058

RESUMEN

Respiratory tract infections such as the ongoing coronavirus disease 2019 (COVID-19) has seriously threatened public health in the last decades. The experience of fighting against the epidemic highlights the importance of user-friendly and accessible point-of-care systems for nucleic acid (NA) detection. To realize low-cost and multiplexed point-of-care NA detection, a swing-assisted multiplexed analyzer for point-of-care respiratory tract infection testing (SMART) was proposed to detect multiple respiratory tract pathogens using visible loop-mediated isothermal amplification. By performing hand-swing movements to generate acceleration force to distribute samples into reaction chambers, the design of the SMART system was greatly simplified. By using different format of chips and integrating into a suitcase, this system can be applied to on-site multitarget and multi-sample testing. Three targets including the N and Orf genes of SARS-CoV-2 and the internal control were simultaneously analyzed (limit of detection: 2000 copies/mL for raw sample; 200 copies/mL for extracted sample). Twenty-three clinical samples with eight types of respiratory bacteria and twelve COVID-19 clinical samples were successfully detected. These results indicate that the SMART system has the potential to be further developed as a versatile tool in the diagnosis of respiratory tract infection.


Asunto(s)
COVID-19 , Infecciones del Sistema Respiratorio , Humanos , SARS-CoV-2 , Sistemas de Atención de Punto , Sensibilidad y Especificidad , Técnicas de Diagnóstico Molecular/métodos , Técnicas de Amplificación de Ácido Nucleico/métodos
14.
Anal Chem ; 95(2): 1599-1607, 2023 01 17.
Artículo en Inglés | MEDLINE | ID: covidwho-2185433

RESUMEN

SARS-CoV-2, especially the variant strains, is rapidly spreading around the world. Rapid detection methods for the virus are crucial for controlling the COVID-19 epidemic. Herein, a localized surface plasmonic resonance (LSPR) biosensor based on Ω-shaped fiber optic (Ω-FO) was developed for dual assays of SARS-CoV-2 monitoring. Due to its strong ability to control the orientation and density, a new T-shaped aptamer exhibits enhanced binding affinity toward N proteins. After being combined on the fiber optic surface, the T-shaped aptamer sensitively captured N proteins of SARS-CoV-2 for a direct assay. Further, core-shell structured gold/silver nanoparticles functionalized with a T-shaped aptamer (apt-Ag@AuNPs) can amplify the signal of N protein detection for a sandwich assay. The real-time analytical feature of the dual assays endows time-dependent sensitivity enhancement behavior, which provides a guideline to save analytical time. With those characteristics, the LSPR biosensor has been successfully used to rapidly identify 39 healthy volunteers and 39 COVID-19 patients infected with the ancestral or variant SARS-CoV-2. With the help of simple pretreatment, we obtain a true negative rate of 100% and a true positive rate of 92.3% with a short analysis time of 45 min using the direct assay. Further, the LSPR biosensor could also broaden the detection application range to the surface of cold-chain foods using a sandwich assay. Thus, the LSPR biosensor based on Ω-FO was demonstrated to have broad application potential to detect SARS-CoV-2 rapidly.


Asunto(s)
Técnicas Biosensibles , COVID-19 , Nanopartículas del Metal , Humanos , Resonancia por Plasmón de Superficie/métodos , SARS-CoV-2 , Oro , COVID-19/diagnóstico , Plata , Técnicas Biosensibles/métodos , Oligonucleótidos
15.
Electronics ; 12(1):80, 2023.
Artículo en Inglés | MDPI | ID: covidwho-2166348

RESUMEN

In recent years, chest X-ray (CXR) imaging has become one of the significant tools to assist in the diagnosis and treatment of novel coronavirus pneumonia. However, CXR images have complex-shaped and changing lesion areas, which makes it difficult to identify novel coronavirus pneumonia from the images. To address this problem, a new deep learning network model (BoT-ViTNet) for automatic classification is designed in this study, which is constructed on the basis of ResNet50. First, we introduce multi-headed self-attention (MSA) to the last Bottleneck block of the first three stages in the ResNet50 to enhance the ability to model global information. Then, to further enhance the feature expression performance and the correlation between features, the TRT-ViT blocks, consisting of Transformer and Bottleneck, are used in the final stage of ResNet50, which improves the recognition of complex lesion regions in CXR images. Finally, the extracted features are delivered to the global average pooling layer for global spatial information integration in a concatenated way and used for classification. Experiments conducted on the COVID-19 Radiography database show that the classification accuracy, precision, sensitivity, specificity, and F1-score of the BoT-ViTNet model is 98.91%, 97.80%, 98.76%, 99.13%, and 98.27%, respectively, which outperforms other classification models. The experimental results show that our model can classify CXR images better.

16.
Sheng Wu Yi Xue Gong Cheng Xue Za Zhi ; 39(5): 1005-1014, 2022 Oct 25.
Artículo en Chino | MEDLINE | ID: covidwho-2100336

RESUMEN

We aim to screen out the active components that may have therapeutic effect on coronavirus disease 2019 (COVID-19) from the severe and critical cases' prescriptions in the "Coronavirus Disease 2019 Diagnosis and Treatment Plan (Trial Ninth Edition)" issued by the National Health Commission of the People's Republic of China and explain its mechanism through the interactions with proteins. The ETCM database and SwissADME database were used to screen the active components contained in 25 traditional Chinese medicines in 3 prescriptions, and the PDB database was used to obtain the crystal structures of 4 proteins of severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). Molecular docking was performed using Autodock Vina and molecular dynamics simulations were performed using GROMACS. Binding energy results showed that 44 active ingredients including xambioona, gancaonin L, cynaroside, and baicalin showed good binding affinity with multiple targets of SARS-CoV-2, while molecular dynamics simulations analysis showed that xambioona bound more tightly to the nucleocapsid protein of SARS-CoV-2 and exerted a potent inhibitory effect. Modern technical methods are used to study the active components of traditional Chinese medicine and show that xambioona is an effective inhibitor of SARS-CoV-2 nucleocapsid protein, which provides a theoretical basis for the development of new anti-SARS-CoV-2 drugs and their treatment methods.


Asunto(s)
Tratamiento Farmacológico de COVID-19 , Humanos , SARS-CoV-2 , Simulación del Acoplamiento Molecular , Medicina Tradicional China , Simulación de Dinámica Molecular , Proteínas de la Nucleocápside , Antivirales/uso terapéutico , Antivirales/química , Antivirales/farmacología
17.
Genes (Basel) ; 13(11)2022 11 04.
Artículo en Inglés | MEDLINE | ID: covidwho-2099423

RESUMEN

Childhood obesity has affected the health of millions of children around the world despite vigorous efforts by health experts. The obesity epidemic in the United States has disproportionately afflicted certain racial and ethnic minority groups. African American children are more likely than other children to have obesity-related risk factors such as hyperlipidemia, diabetes, cardiovascular disease, and coronavirus disease (COVID-19). For the reduction in obesity-related health inequalities to be successful, it is essential to identify the variables affecting various groups. A notable advancement in epigenetic biology has been made over the past decade. Epigenetic changes like DNA methylation impact on many genes associated with obesity. Here, we evaluated the DNA methylation levels of the genes NRF1, FTO, and LEPR from the saliva of children using real-time quantitative PCR-based multiplex MethyLight technology. ALU was used as a reference gene, and the Percent of Methylated Reference (PMR) was calculated for each sample. European American children showed a significant increase in PMR of NRF1 and FTO in overweight/obese participants compared to normal weight, but not in African American children. After adjusting for maternal education and annual family income by regression analysis, the PMR of NRF1 and FTO was significantly associated with BMI z-score only in European American children. While for the gene LEPR, African American children had higher methylation in normal weight participants as compared to overweight/obese and no methylation difference in European American children. The PMR of LEPR was significantly negative associated with the obesity measures only in African American children. These findings contribute to a race-specific link between NRF1, FTO, and LEPR gene methylation and childhood obesity.


Asunto(s)
COVID-19 , Obesidad Pediátrica , Niño , Humanos , Dioxigenasa FTO Dependiente de Alfa-Cetoglutarato/genética , COVID-19/genética , Etnicidad , Grupos Minoritarios , Sobrepeso , Obesidad Pediátrica/epidemiología , Estados Unidos
18.
Int J Environ Res Public Health ; 19(20)2022 Oct 20.
Artículo en Inglés | MEDLINE | ID: covidwho-2082313

RESUMEN

The coronavirus disease 2019 (COVID-19) pandemic has posed a profound psychological impact on healthcare workers. However, the role of positive affect in moderating the effect of perceived stress on the psychological states of healthcare workers remains unknown. This study aimed to analyze the moderating effect of positive affect on the association between stress and the mental health of healthcare workers during the COVID-19 pandemic. This cross-sectional study evaluated the relationships between perceived stress (the Perceived Stress Scale), positive affect (the Positive and Negative Affect Schedule), depression (the Patient Health Questionnaire-9), and anxiety (the Generalized Anxiety Disorder 7-item Scale) during the COVID-19 pandemic in 644 Chinese healthcare workers who completed online self-reports. The results revealed a significant negative association between positive affect and psychological problems, including stress, depression, and anxiety. At the total group level, multiple regression analysis showed that positive affect alleviated the influence of perceived stress on depression, but no significant moderating effect was found for anxiety. In the subgroups divided by perceived stress, the moderating effect of positive affect on depression was only significant in healthcare workers with a high level of perceived stress. These results suggested that positive affect played a moderative role in alleviating the effect of stress on depression among healthcare workers, particularly those with a high level of stress, thus emphasizing the importance of positive affect as an intervention strategy for promoting the mental health of healthcare workers in the context of the ongoing COVID-19 pandemic.


Asunto(s)
COVID-19 , Pandemias , Humanos , COVID-19/epidemiología , Salud Mental , Estudios Transversales , SARS-CoV-2 , Depresión/epidemiología , Personal de Salud/psicología , Ansiedad/epidemiología , Estrés Psicológico/epidemiología
19.
Arch Med Sci ; 18(5): 1262-1270, 2022.
Artículo en Inglés | MEDLINE | ID: covidwho-2025069

RESUMEN

Introduction: Coronavirus disease 2019 (COVID-19) is associated with severe emotional changes. This research aims to investigate the prevalence of anxiety and depression in COVID-19 patients and its relationship with disease severity, sleep patterns, lifestyle, and specific laboratory test results. Material and methods: An observational study of 52 Chinese patients with COVID-19 was conducted to assess the relation between anxiety and depression (evaluated with the Hospital Anxiety and Depression Scale) and laboratory findings (lymphocytes, C-reactive proteins, leukocytes, alanine aminotransferase, aspartate aminotransferase). The relationships between the severity of COVID-19 in patients, the Insomnia Severity Index (ISI) score, and the Hospital Anxiety and Depression Scale (HADS) score were also investigated. Results: There were statistically significant associations between disease, smoking, and HADS-A scores (p = 0.011/0.020). The HADS-D score of patients with the disease was higher than in those without a past medical history (p = 0.008). The difference in C-reactive protein (CRP) between different lung infections, the HADS-A and HADS-D scores between different ages and ISI groups, and the correlation between the two scores were statistically significant. Conclusions: Anxiety and depression are associated with poor sleep quality, smoking, and past medical history in patients with COVID-19. Additionally, anxiety and depression were seen to coexist, and there was a positive correlation between them. Further, the inflammatory index CRP was significantly increased in bilateral lung infections.

20.
Healthcare (Basel) ; 10(8)2022 Jul 28.
Artículo en Inglés | MEDLINE | ID: covidwho-2023369

RESUMEN

Stroke survivors with aphasia (SsWA) tend to experience high levels of anxiety and stress, leading to an increased risk of recurrent strokes. Mindfulness and/or relaxation that does not require language outputs could reduce psychosocial stress; however, these approaches work best if they consist of a range of techniques and are modified to suit the needs of SsWA. Using a mixed-methods approach, we examined the feasibility and acceptability of a set of tailored mindfulness and relaxation techniques for SsWA. Nine SsWA were recruited (six men and three women, median age = 51 years). Four relaxation and mindfulness techniques which had been tailored for SsWA were filmed into a DVD/YouTube video and were given to participants together with a practice diary for home practice once daily for 5 weeks. The participants joined focus group discussions and completed a feasibility scale 5 weeks later. The participants perceived these techniques as easy, user-friendly and acceptable for SsWA in general. Although practised less often than instructed, many participants reported benefits of regular practice. The perceived relevance of these techniques to the participants' own situations and the intention to continue varied. Future research could encourage the regular practice of self-help interventions by incorporating behavioural change techniques such as using prompts and cues.

SELECCIÓN DE REFERENCIAS
DETALLE DE LA BÚSQUEDA